Top » Catalog » SNPs » ZS5000

$18.00

ZS5000
[ZS5000]

ZS5000
hg38 Position: ChrY:12918971..12918971
Ancestral: T
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC5. Found in Big Y sample 152929
Forward Primer: ZS5000_F CTGGATAGGCACTTGGGAAC
Reverse Primer: ZS5000_R TTAAAGCCTGCTGCACAATC
Reviews

Customers who bought this product also purchased
BY194659
BY194659
FGC87741
FGC87741
ZS7725
ZS7725
FGC4474
FGC4474
Y215899
Y215899
ZS5005
ZS5005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies