Top » Catalog » SNPs » ZS5000

$18.00

ZS5000
[ZS5000]

ZS5000
hg38 Position: ChrY:12918971..12918971
Ancestral: T
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC5. Found in Big Y sample 152929
Forward Primer: ZS5000_F CTGGATAGGCACTTGGGAAC
Reverse Primer: ZS5000_R TTAAAGCCTGCTGCACAATC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
Z31200
Z31200
M81
M81
ZS4753
ZS4753
ZS11431
ZS11431
FTB35151
FTB35151
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies