Top » Catalog » SNPs » BY411

$18.00

BY411
[BY411]

BY411
hg38 Position: ChrY:2970076..2970076
Ancestral: A
Derived: G
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f2c1 (not listed)
Comments: Downstream Z253 > L1066
Forward Primer: BY411_F AGTCAGGGGCATAGGAGTTG
Reverse Primer: BY411_R CAACCAAAATCTGCCCAAAC
Reviews (1)

Customers who bought this product also purchased
FGC37022
FGC37022
FGC43048
FGC43048
FT239671
FT239671
Y207632
Y207632
FT196681
FT196681
BY2707
BY2707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies