Top » Catalog » SNPs » Y6951

$18.00

Y6951
[Y6951]

Y6951
hg38 Position: ChrY:16675375..16675375
Ancestral: G
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: R1b1a2a1a2a1b2 (not listed)
Comments: Downstream DF27 > Y6954
Forward Primer: Y6951_F TCAACTAGCAGCTGGACAATC
Reverse Primer: Y6951_R ATCCCAGGACCCAACACAG
Reviews

Customers who bought this product also purchased
FGC22213
FGC22213
L48
L48
BY21438
BY21438
FT43199
FT43199
Y38083
Y38083
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies