Top » Catalog » SNPs » YP1236

$18.00

YP1236
[YP1236]

YP1236
hg38 Position: ChrY:2866425..2866425
Ancestral: C
Derived: G
Reference: Vladimir Gurianov (2015)
ISOGG Haplogroup: Q1b1a1a2a1a
Comments: .
Forward Primer: YP1236_F TTTGAGAGAAGTGGTACAGAGGC
Reverse Primer: YP1236_R GAGGTTATCTGCCTCTCACAGTC
Reviews

Customers who bought this product also purchased
YP4585
YP4585
L275
L275
L53
L53
Y18604
Y18604
L56
L56
YP1237
YP1237
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies