Top » Catalog » SNPs » YP1236

$18.00

YP1236
[YP1236]

YP1236
hg38 Position: ChrY:2866425..2866425
Ancestral: C
Derived: G
Reference: Vladimir Gurianov (2015)
ISOGG Haplogroup: Q1b1a1a2a1a
Comments: .
Forward Primer: YP1236_F TTTGAGAGAAGTGGTACAGAGGC
Reverse Primer: YP1236_R GAGGTTATCTGCCTCTCACAGTC
Reviews

Customers who bought this product also purchased
L53
L53
Y18604
Y18604
L56
L56
YP1237
YP1237
Q Superclade Panel
Q Superclade Panel
YP1251
YP1251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies