Top » Catalog » SNPs » YP1251

$18.00

YP1251
[YP1251]

YP1251
hg38 Position: ChrY:20667702..20667702
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: Q1b1a1a2a1a
Comments: .
Forward Primer: YP1251_F GCTCAGATCACGAGGTCAGG
Reverse Primer: YP1251_R GGAGATGATGGACCAAGCAG
Reviews

Customers who bought this product also purchased
Y2220
Y2220
YP1095
YP1095
Q1b-L275 Panel
Q1b-L275 Panel
YP745
YP745
L275
L275
YP4585
YP4585
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies