Top » Catalog » SNPs » YP1251

$18.00

YP1251
[YP1251]

YP1251
hg38 Position: ChrY:20667702..20667702
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: Q1b1a1a2a1a
Comments: .
Forward Primer: YP1251_F GCTCAGATCACGAGGTCAGG
Reverse Primer: YP1251_R GGAGATGATGGACCAAGCAG
Reviews

Customers who bought this product also purchased
L275
L275
YP4585
YP4585
Y18604
Y18604
L53
L53
Y2197
Y2197
YP1237
YP1237
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies