Top » Catalog » SNPs » A2145

$18.00

A2145
[A2145]

A2145
hg38 Position: ChrY:14327654..14327654
Ancestral: A
Derived: G
Reference: Richard Hulan (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A2145_F CACAAAGATACCTCTCTAAGCAAGG
Reverse Primer: A2145_R AAAACTATGCAAAATGAAACATAAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies