Top » Catalog » SNPs » A2146

$18.00

A2146
[A2146]

A2146
hg38 Position: ChrY:21270624..21270624
Ancestral: C
Derived: T
Reference: Richard Hulan (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A2146_F AGCCAGCATCATATTGACTGAG
Reverse Primer: A2146_R CATTGTAGTCATCTTTCATTGCTTTAG
Reviews

Customers who bought this product also purchased
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
FGC46562
FGC46562
S493
S493
V7594
V7594
BY156463
BY156463
Z381
Z381
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies