Top » Catalog » SNPs » M406

$18.00

M406
[M406]

M406
hg38 Position: ChrY:2881954..2881954
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: G2a2b1
Comments: .
Forward Primer: M406_F TGTTACCCCTTTGGTGGAAG
Reverse Primer: M406_R TCAACTGACCCAGTCAGAAGC
Reviews

Customers who bought this product also purchased
Z6029
Z6029
Z6350
Z6350
S11726
S11726
Z6343
Z6343
CTS9957
CTS9957
Z6354
Z6354
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies