Top » Catalog » SNPs » M406

$18.00

M406
[M406]

M406
hg38 Position: ChrY:2881954..2881954
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: G2a2b1
Comments: .
Forward Primer: M406_F TGTTACCCCTTTGGTGGAAG
Reverse Primer: M406_R TCAACTGACCCAGTCAGAAGC
Reviews

Customers who bought this product also purchased
L14
L14
mtComplete
mtComplete
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Z6350
Z6350
S11726
S11726
Z6343
Z6343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies