Top » Catalog » SNPs » A2158

$18.00

A2158
[A2158]

A2158
hg38 Position: ChrY:14118731..14118731
Ancestral: A
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of Z251 > Z18098
Forward Primer: A2158_F AGCTGTCCATGCAGACCAG
Reverse Primer: A2158_R CTCTTTTGCATAAAGGGTTCTCC
Reviews

Customers who bought this product also purchased
L21
L21
A8
A8
FGC11986
FGC11986
Z39589
Z39589
S1051
S1051
A555
A555
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A342
1 x A1080
1 x A694
1 x A2170
1 x A7
1 x A1766
1 x A1141
1 x A570
1 x A2071
1 x A683
1 x A2146
1 x A554
1 x A970
1 x A680
1 x A191
1 x A185
1 x A463
1 x A415
1 x A1201
1 x A445
1 x A1117
$378.00
Haplogroup Info
Other products
Currencies