Top » Catalog » SNPs » L1019

$18.00

L1019
[L1019]

L1019
hg38 Position: ChrY:14526872..14526872
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1a1b1a6~
Comments: Found in a hg E-V13 WTY participant
Forward Primer: L1019_F CTTCATATACAGTAGGCCCTAAAACC
Reverse Primer: L1019_R AAAAGGTCATTCGGTCATGC
Reviews

Customers who bought this product also purchased
FGC14560
FGC14560
FGC19313
FGC19313
FGC14565
FGC14565
Z5018
Z5018
E1b-L1019 Goodrich Panel
E1b-L1019 Goodrich Panel
FGC14572
FGC14572
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies