Top » Catalog » SNPs » L1019

$18.00

L1019
[L1019]

L1019
hg38 Position: ChrY:14526872..14526872
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1a1b1a6~
Comments: Found in a hg E-V13 WTY participant
Forward Primer: L1019_F CTTCATATACAGTAGGCCCTAAAACC
Reverse Primer: L1019_R AAAAGGTCATTCGGTCATGC
Reviews

Customers who bought this product also purchased
FGC14570
FGC14570
FGC14557
FGC14557
FGC19306
FGC19306
FGC14562
FGC14562
FGC19315
FGC19315
FGC14567
FGC14567
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies