Top » Catalog » SNPs » FGC10135

$18.00

FGC10135
[FGC10135]

FGC10135
HG19 Position: ChrY:6672130..6672130
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person. Downstream of S588 S7049
Forward Primer: FGC10135v2_F TACTTAACAGTGTTGATCTCTTGCG
Reverse Primer: FGC10135v2_R CACTATGTTGCCCACACTGC
Reviews

Customers who bought this product also purchased
A5388
A5388
S603
S603
S659
S659
S590
S590
M222
M222
FGC4113
FGC4113
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies