Top » Catalog » SNPs » FGC10135

$18.00

FGC10135
[FGC10135]

FGC10135
HG19 Position: ChrY:6672130..6672130
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person. Downstream of S588 S7049
Forward Primer: FGC10135v2_F TACTTAACAGTGTTGATCTCTTGCG
Reverse Primer: FGC10135v2_R CACTATGTTGCCCACACTGC
Reviews

Customers who bought this product also purchased
S590
S590
M222
M222
FGC4113
FGC4113
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
FGC23592
FGC23592
A5388
A5388
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies