Top » Catalog » SNPs » FGC10135

$18.00

FGC10135
[FGC10135]

FGC10135
hg38 Position: ChrY:6804089..6804089
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person. Downstream of S588 > FGC10137
Forward Primer: FGC10135v2_F TACTTAACAGTGTTGATCTCTTGCG
Reverse Primer: FGC10135v2_R CACTATGTTGCCCACACTGC
Reviews

Customers who bought this product also purchased
BY13680
BY13680
FGC19831
FGC19831
A10535
A10535
A16089
A16089
S7814
S7814
A16088
A16088
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies