Top » Catalog » SNPs » FGC10138

$18.00

FGC10138
[FGC10138]

FGC10138
hg38 Position: ChrY:7468048..7468048
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person. Downstream of S588 S7049
Forward Primer: FGC10138_F GGTCTTGCTGACTCGGTAGTGT
Reverse Primer: FGC10138_R TGGGCAATATAGTTAGATCATTTCATTAC
Reviews

Customers who bought this product also purchased
S603
S603
FGC64966
FGC64966
S7814
S7814
BY13680
BY13680
M222
M222
FGC19831
FGC19831
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies