Top » Catalog » SNPs » FGC10138

$18.00

FGC10138
[FGC10138]

FGC10138
HG19 Position: ChrY:7468048..7468048
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person. Downstream of S588 S7049
Forward Primer: FGC10138_F GGTCTTGCTGACTCGGTAGTGT
Reverse Primer: FGC10138_R TGGGCAATATAGTTAGATCATTTCATTAC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies