Top » Catalog » SNPs » FGC5552

$18.00

FGC5552
[FGC5552]

FGC5552
hg38 Position: ChrY:20680868..20680868
Ancestral: A
Derived: T
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5552_F CAGCACAGTGGCTTGTACTTG
Reverse Primer: FGC5552_R GCTGCATTCATGTTACAAAAGC
Reviews

Customers who bought this product also purchased
FGC5538
FGC5538
FGC5551
FGC5551
FGC5510
FGC5510
FGC5523
FGC5523
FGC5537
FGC5537
FGC5544
FGC5544
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies