Top » Catalog » SNPs » FGC5552

$18.00

FGC5552
[FGC5552]

FGC5552
hg38 Position: ChrY:20680868..20680868
Ancestral: A
Derived: T
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5552_F CAGCACAGTGGCTTGTACTTG
Reverse Primer: FGC5552_R GCTGCATTCATGTTACAAAAGC
Reviews

Customers who bought this product also purchased
FGC5534
FGC5534
FGC5507
FGC5507
FGC5543
FGC5543
FGC5521
FGC5521
FGC7448
FGC7448
FGC5533
FGC5533
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies