Top » Catalog » SNPs » FGC10147

$18.00

FGC10147
[FGC10147]

FGC10147
hg38 Position: ChrY:19754186..19754186
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person. Downstream of S588 S7049
Forward Primer: FGC10147_F CATGCACGGTGTGCTACATC
Reverse Primer: FGC10147_R AGGTTGTCAGGTTAACACCCTAACT
Reviews

Customers who bought this product also purchased
A10629
A10629
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A5386
A5386
Y9391
Y9391
S7814
S7814
Y81784
Y81784
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies