Top » Catalog » SNPs » FGC10048

$18.00

FGC10048
[FGC10048]

FGC10048
hg38 Position: ChrY:6923935..6923935
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10048_F ACGCTGGGCCTATAACAAAC
Reverse Primer: FGC10048_R TATCACCCACAGTGCACCAG
Reviews

Customers who bought this product also purchased
A148
A148
FGC10071
FGC10071
R1b-L371 Group Panel B
R1b-L371 Group Panel B
YFS066633
YFS066633
FGC10054
FGC10054
FGC10065
FGC10065
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies