Top » Catalog » SNPs » L1066

$18.00

L1066
[L1066]

L1066
hg38 Position: ChrY:7397725..7397725
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1f2c1
Comments: Extracted from 1000 genomes data. Derived in a R-Z253 person
Forward Primer: L1066_F TTCCATCTAACCCCCATCTTC
Reverse Primer: L1066_R ATTGGACGCTTTGGAGTGAC
Reviews

Customers who bought this product also purchased
FGC5639
FGC5639
R1b-DF27 Panel
R1b-DF27 Panel
M10162
M10162
FGC37012
FGC37012
L21
L21
FGC17244
FGC17244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies