Top » Catalog » SNPs » L1066

$18.00

L1066
[L1066]

L1066
hg38 Position: ChrY:7397725..7397725
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1f2c1
Comments: Extracted from 1000 genomes data. Derived in a R-Z253 person
Forward Primer: L1066_F TTCCATCTAACCCCCATCTTC
Reverse Primer: L1066_R ATTGGACGCTTTGGAGTGAC
Reviews

Customers who bought this product also purchased
Y207632
Y207632
FT196681
FT196681
BY2707
BY2707
BY19824
BY19824
FT32367
FT32367
FGC37022
FGC37022
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies