Top » Catalog » SNPs » FGC10059

$18.00

FGC10059
[FGC10059]

FGC10059
hg38 Position: ChrY:12530241..12530241
Ancestral: T
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10059_F ATGGCTCAACGTTTCTTTGC
Reverse Primer: FGC10059_R AAGGCAACTAGAGATTGCCAAC
Reviews

Customers who bought this product also purchased
BY3927
BY3927
DF63
DF63
BY54624
BY54624
A7907
A7907
BY20463
BY20463
A5846
A5846
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies