Top » Catalog » SNPs » FGC10059

$18.00

FGC10059
[FGC10059]

FGC10059
hg38 Position: ChrY:12530241..12530241
Ancestral: T
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10059_F ATGGCTCAACGTTTCTTTGC
Reverse Primer: FGC10059_R AAGGCAACTAGAGATTGCCAAC
Reviews

Customers who bought this product also purchased
R1b-DF27 Panel
R1b-DF27 Panel
Y18513
Y18513
BY3927
BY3927
DF63
DF63
BY54624
BY54624
A7907
A7907
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies