Top » Catalog » SNPs » FGC10061

$18.00

FGC10061
[FGC10061]

FGC10061
hg38 Position: ChrY:13483341..13483341
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10061_F GTTCTCATTGTTCAATTCCCAA
Reverse Primer: FGC10061_R GGAAACAACAGATACTTGCAAGTACA
Reviews

Customers who bought this product also purchased
FGC10071
FGC10071
R1b-L371 Group Panel B
R1b-L371 Group Panel B
YFS066633
YFS066633
FGC10052
FGC10052
FGC10065
FGC10065
FGC10083
FGC10083
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S15732
1 x ZS11628
$36.00
Haplogroup Info
Other products
Currencies