Top » Catalog » SNPs » FGC10061

$18.00

FGC10061
[FGC10061]

FGC10061
hg38 Position: ChrY:13483341..13483341
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10061_F GTTCTCATTGTTCAATTCCCAA
Reverse Primer: FGC10061_R GGAAACAACAGATACTTGCAAGTACA
Reviews

Customers who bought this product also purchased
FGC10083
FGC10083
FGC10051
FGC10051
FGC10062
FGC10062
FGC10081
FGC10081
FGC10048
FGC10048
FGC10060
FGC10060
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies