Top » Catalog » SNPs » FGC10062

$18.00

FGC10062
[FGC10062]

FGC10062
hg38 Position: ChrY:13573134..13573134
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10062_F TCCAATCTCCCAAGTCTGAAG
Reverse Primer: FGC10062_R TGTACTGCTGGGTTGGATTG
Reviews

Customers who bought this product also purchased
A148
A148
FGC10073
FGC10073
FGC10037
FGC10037
FGC10054
FGC10054
FGC10071
FGC10071
R1b-L371 Group Panel B
R1b-L371 Group Panel B
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies