Top » Catalog » SNPs » FGC10062

$18.00

FGC10062
[FGC10062]

FGC10062
hg38 Position: ChrY:13573134..13573134
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10062_F TCCAATCTCCCAAGTCTGAAG
Reverse Primer: FGC10062_R TGTACTGCTGGGTTGGATTG
Reviews

Customers who bought this product also purchased
FGC10061
FGC10061
FGC10081
FGC10081
FGC10048
FGC10048
FGC10060
FGC10060
FGC10080
FGC10080
FGC10047
FGC10047
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies