Top » Catalog » SNPs » BY178617

$18.00

BY178617
[BY178617]

BY178617
hg38 Position: ChrY:12085159..12085159
Ancestral: T
Derived: C
Reference: Ed Aber Leek (2018)
ISOGG Haplogroup: R1b
Comments: Below Z3004 > FGC41930 > FGC41929
Forward Primer: BY178617_F GGAAGAGCTGGAATTAAACAGATTC
Reverse Primer: BY178617_R GGAAGAGCACCAAGAACTTAAGATG
Reviews

Customers who bought this product also purchased
A25199
A25199
A25198
A25198
FGC41933
FGC41933
FGC41927
FGC41927
BY179671
BY179671
FGC41934
FGC41934
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies