Top » Catalog » SNPs » A23461

$18.00

A23461
[A23461]

A23461
hg38 Position: ChrY:7560201..7560201
Ancestral: T
Derived: G
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: S17624 > S11481 > S21770 > FGC69356
Forward Primer: A23461_F TGGTGCTACCAGGCGCT
Reverse Primer: A23461_R AGAGCTCCTCCATGGATTCC
Reviews

Customers who bought this product also purchased
A23462
A23462
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
Whole Genome Sequence
Whole Genome Sequence
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies