Top » Catalog » SNPs » A23461

$15.00

A23461
[A23461]

A23461
hg38 Position: ChrY:7560201..7560201
Ancestral: T
Derived: G
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: S17624 > S11481 > S21770 > FGC69356
Forward Primer: A23461_F TGGTGCTACCAGGCGCT
Reverse Primer: A23461_R AGAGCTCCTCCATGGATTCC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
Whole Genome Sequence
Whole Genome Sequence
A23462
A23462
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies