Top » Catalog » SNPs » A23462

$18.00

A23462
[A23462]

A23462
hg38 Position: ChrY:18897980..18897980
Ancestral: C
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: S17624 > S11481 > S21770 > FGC69356
Forward Primer: A23462_F ATGCAAGGCTGGTTGAATATATG
Reverse Primer: A23462_R GAGACAATGCGGTTTTCTACATATACT
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Whole Genome Sequence
Whole Genome Sequence
A23461
A23461
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies