Top » Catalog » SNPs » A23462

$18.00

A23462
[A23462]

A23462
hg38 Position: ChrY:18897980..18897980
Ancestral: C
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: S17624 > S11481 > S21770 > FGC69356
Forward Primer: A23462_F ATGCAAGGCTGGTTGAATATATG
Reverse Primer: A23462_R GAGACAATGCGGTTTTCTACATATACT
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
Whole Genome Sequence
Whole Genome Sequence
A23461
A23461
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18435
$18.00
Haplogroup Info
Other products
Currencies