Top » Catalog » SNPs » A23463

$18.00

A23463
[A23463]

A23463
hg38 Position: ChrY:11877361..11877361
Ancestral: C
Derived: T
Reference: YSEQ (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A23463_F GGGATTGCAGCTGCTGG
Reverse Primer: A23463_R GTGCTTGTAGTCACAGCTACACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A23490
1 x Y66192
1 x YSEQ-Beta
$94.00
Haplogroup Info
Other products
Currencies