Top » Catalog » SNPs » BY31340

$18.00

BY31340
[BY31340]

BY31340
hg38 Position: ChrY:15386431..15386431
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY31340_F GTATTTAATAAATAGCTGCTGGTCTGG
Reverse Primer: BY31340_R TGGACCAATCAGGAGGAGG
Reviews (1)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies