Top » Catalog » SNPs » FGC11446

$19.00

FGC11446
[FGC11446]

FGC11446
hg38 Position: ChrY:9967964..9967964
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: E1b1b
Comments: Z1057 > CTS1273 > Z5018 > S2979 > FGC11457 > FGC11450 > FGC11447
Forward Primer: FGC11446_F GGGATTCTGTTTCAGCAAGATG
Reverse Primer: FGC11446_R TTGGCAGGCAAATCACG
Reviews

Customers who bought this product also purchased
M343
M343
BY68094
BY68094
V13
V13
Z37873
Z37873
Y250294
Y250294
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies