Top » Catalog » SNPs » ZQ103

$18.00

ZQ103
[ZQ103]

ZQ103
hg38 Position: ChrY:20566118..20566118
Ancestral: C
Derived: G
Reference: Gabit Baimbetov (2017)
ISOGG Haplogroup: C2b1a2a
Comments: .
Forward Primer: ZQ103_F GCATTTCACTTTGTGTTTCTTTG
Reverse Primer: ZQ103_R TAGTAGTGGCTGTAGTGGCTTCTTATG
Reviews

Customers who bought this product also purchased
ZQ104
ZQ104
ZQ105
ZQ105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies