Top » Catalog » SNPs » ZQ105

$18.00

ZQ105
[ZQ105]

ZQ105
hg38 Position: ChrY:15279321..15279321
Ancestral: A
Derived: G
Reference: Gabit Baimbetov (2017)
ISOGG Haplogroup: C2b1a2a
Comments: .
Forward Primer: ZQ105_F ATAGCTGAGGTGAAAATGATTTGGTAC
Reverse Primer: ZQ105_R CATTTCCACACTTAATTAACTTTCTTCTG
Reviews

Customers who bought this product also purchased
ZQ104
ZQ104
ZQ103
ZQ103
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies