Top » Catalog » SNPs » FGC85567

$18.00

FGC85567
[FGC85567]

FGC85567
hg38 Position: ChrY:2948556..2948556
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: Z2980 > Z2976 > DF23 > Z2961 > A1
Forward Primer: FGC85567_F TGTGTCATTGAGCAGCCTTC
Reverse Primer: FGC85567_R AGCAACCCCATCAGATTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies