Top » Catalog » SNPs » A14410

$18.00

A14410
[A14410]

A14410
hg38 Position: ChrY:13373828..13373828
Ancestral: T
Derived: A
Reference: William Hartley
ISOGG Haplogroup: I1
Comments: Downstream I1-DF29 Y11867+
Forward Primer: A14410_F TAAAAACCAGATGGGCATGG
Reverse Primer: A14410_R AGGGGCTGCAGTCAGAAGAG
Reviews

Customers who bought this product also purchased
A14411
A14411
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies