Top » Catalog » SNPs » A14411

$18.00

A14411
[A14411]

A14411
hg38 Position: ChrY:14844090..14844090
Ancestral: A
Derived: G
Reference: William Hartley
ISOGG Haplogroup: I1
Comments: Below DF29 > Y11205
Forward Primer: A14411_F CTTTGTACAAACAATTATGCATCTG
Reverse Primer: A14411_R GCTTTCTATTTGAAACCATTAAGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies