Top » Catalog » SNPs » Y132492

$18.00

Y132492
[Y132492]

Y132492
hg38 Position: ChrY:11916467..11916467
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y132492_F CTTCTTGTATCCCTTCAACTTCCC
Reverse Primer: Y132492_R AGCCATAATTGGAACTGGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies