Top » Catalog » SNPs » A23499

$18.00

A23499
[A23499]

A23499
hg38 Position: ChrY:20718315..20718315
Ancestral: T
Derived: A
Reference: Karl Schrock (2018)
ISOGG Haplogroup: J2
Comments: Below Y125345
Forward Primer: A23499_F CTGTTTGCTGACGATATAATTGGG
Reverse Primer: A23499_R TTCACAATAATGATTCTACCGATCTC
Reviews

Customers who bought this product also purchased
A23498
A23498
A23497
A23497
A23496
A23496
A23495
A23495
A23494
A23494
A22122
A22122
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies