Top » Catalog » SNPs » BY4474

$18.00

BY4474
[BY4474]

BY4474
hg38 Position: ChrY:13028440..13028440
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY4474_F GGTTGCTGTACCATCCTCAG
Reverse Primer: BY4474_R TACCATGGAGCTTCTTCCAC
Reviews

Customers who bought this product also purchased
BY4472
BY4472
A19254
A19254
BY4471
BY4471
BY4477
BY4477
BY4476
BY4476
BY4475
BY4475
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies