Top » Catalog » SNPs » BY25318

$18.00

BY25318
[BY25318]

BY25318
hg38 Position: ChrY:9808566..9808566
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY25318_F CACACCAAAATATCAGACATCTACTG
Reverse Primer: BY25318_R TACAGTGGATAGAAGGAAATGCTTC
Reviews

Customers who bought this product also purchased
BY171286
BY171286
L2
L2
DF90
DF90
BY38635
BY38635
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
FGC4183
FGC4183
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies