Top » Catalog » SNPs » BY25318

$18.00

BY25318
[BY25318]

BY25318
hg38 Position: ChrY:9808566..9808566
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY25318_F CACACCAAAATATCAGACATCTACTG
Reverse Primer: BY25318_R TACAGTGGATAGAAGGAAATGCTTC
Reviews

Customers who bought this product also purchased
FGC4183
FGC4183
A1718
A1718
FT410015
FT410015
FGC22538
FGC22538
Y3964
Y3964
BY25320
BY25320
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies