Top » Catalog » SNPs » BY25318

$18.00

BY25318
[BY25318]

BY25318
hg38 Position: ChrY:9808566..9808566
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY25318_F CACACCAAAATATCAGACATCTACTG
Reverse Primer: BY25318_R TACAGTGGATAGAAGGAAATGCTTC
Reviews

Customers who bought this product also purchased
Z367
Z367
DF110
DF110
BY171286
BY171286
L2
L2
DF90
DF90
BY38635
BY38635
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies