Top » Catalog » SNPs » Y125026

$18.00

Y125026
[Y125026]

Y125026
hg38 Position: ChrY:14068330..14068330
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y125026_F TTCCCCCAAACAACACCTAC
Reverse Primer: Y125026_R GCCAGTACCACGCTGTTTTG
Reviews

Customers who bought this product also purchased
I2 Superclade Panel
I2 Superclade Panel
Y177575
Y177575
M253
M253
A577
A577
Z59
Z59
Y31038
Y31038
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies